ID: 1158516612_1158516617

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1158516612 1158516617
Species Human (GRCh38) Human (GRCh38)
Location 18:58135881-58135903 18:58135926-58135948
Sequence CCGTGTTTCTTGAAGAAGACGTT GGCCATACCCCTTGTGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 178} {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!