ID: 1159289638_1159289640

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1159289638 1159289640
Species Human (GRCh38) Human (GRCh38)
Location 18:66399154-66399176 18:66399170-66399192
Sequence CCATTACACAAATGCTGATGCTA GATGCTATAATTCATCTTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!