ID: 1159398642_1159398645

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1159398642 1159398645
Species Human (GRCh38) Human (GRCh38)
Location 18:67900298-67900320 18:67900328-67900350
Sequence CCGTAAAACTCCTAGGAGAAAAT AAGCTCCTTGACATTGATCTTGG
Strand - +
Off-target summary No data {0: 3, 1: 50, 2: 215, 3: 621, 4: 1206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!