ID: 1159446197_1159446200

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1159446197 1159446200
Species Human (GRCh38) Human (GRCh38)
Location 18:68544501-68544523 18:68544532-68544554
Sequence CCACATGGTGCAGAGAGAGAATC CAGGAGAGTGCAGTGATTGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!