|
Left Crispr |
Right Crispr |
Crispr ID |
1159634665 |
1159634677 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
18:70790091-70790113
|
18:70790133-70790155
|
Sequence |
CCTTCCACCAGCTCCCTCTCATG |
ATTCGAGGTGAGATTTGGGTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 5, 2: 98, 3: 701, 4: 2378} |
{0: 50, 1: 1857, 2: 11259, 3: 12081, 4: 9689} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|