ID: 1159634666_1159634678

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1159634666 1159634678
Species Human (GRCh38) Human (GRCh38)
Location 18:70790095-70790117 18:70790134-70790156
Sequence CCACCAGCTCCCTCTCATGACAT TTCGAGGTGAGATTTGGGTGGGG
Strand - +
Off-target summary No data {0: 48, 1: 1782, 2: 11118, 3: 12468, 4: 8696}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!