ID: 1159747590_1159747591

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1159747590 1159747591
Species Human (GRCh38) Human (GRCh38)
Location 18:72257091-72257113 18:72257128-72257150
Sequence CCAGCTCAAGAAGACAGAGAGGA ATCTTTTTTTTTTTTTTATTTGG
Strand - +
Off-target summary No data {0: 2, 1: 140, 2: 2113, 3: 22843, 4: 53377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!