ID: 1160153547_1160153552

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1160153547 1160153552
Species Human (GRCh38) Human (GRCh38)
Location 18:76413634-76413656 18:76413650-76413672
Sequence CCCCCAAATATCTGGGCTGCCAC CTGCCACGGTTTCCTCCCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 130} {0: 1, 1: 0, 2: 0, 3: 9, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!