ID: 1160278804_1160278810

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1160278804 1160278810
Species Human (GRCh38) Human (GRCh38)
Location 18:77466887-77466909 18:77466927-77466949
Sequence CCCTCCTCCTCTTCCTTCTTCTG GCTCCATTATCATTTGTTACAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 109, 3: 736, 4: 4078} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!