ID: 1160380207_1160380211

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1160380207 1160380211
Species Human (GRCh38) Human (GRCh38)
Location 18:78448797-78448819 18:78448820-78448842
Sequence CCCAAATCATGGTTTCTAATAGG ATTCTCCAATAAAAGAAAGAGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 34, 3: 212, 4: 932}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!