ID: 1160498239_1160498248

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1160498239 1160498248
Species Human (GRCh38) Human (GRCh38)
Location 18:79387709-79387731 18:79387749-79387771
Sequence CCTCTCATTGATCTACCCTGAGA TTGGCTCCCGTAGGTGTACCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!