ID: 1160704779_1160704789

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1160704779 1160704789
Species Human (GRCh38) Human (GRCh38)
Location 19:524782-524804 19:524807-524829
Sequence CCAACACCCTCGCCCACCTGGAC CCAGCCCTTCACCACGCCCCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!