ID: 1160709027_1160709034

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1160709027 1160709034
Species Human (GRCh38) Human (GRCh38)
Location 19:542283-542305 19:542320-542342
Sequence CCAGCCTGCGGGACAGGGGCGGC AGTTCCTCCTCCCTGTGACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 316} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!