ID: 1160709030_1160709039

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1160709030 1160709039
Species Human (GRCh38) Human (GRCh38)
Location 19:542313-542335 19:542332-542354
Sequence CCCCCAGAGTTCCTCCTCCCTGT CTGTGACCAGGTGCATCTAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!