ID: 1160765139_1160765142

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1160765139 1160765142
Species Human (GRCh38) Human (GRCh38)
Location 19:804293-804315 19:804312-804334
Sequence CCTTCATCGAGATGAACACGGAG GGAGGAGGCTGCCAACACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 46} {0: 2, 1: 0, 2: 1, 3: 32, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!