ID: 1160796844_1160796858

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1160796844 1160796858
Species Human (GRCh38) Human (GRCh38)
Location 19:949535-949557 19:949585-949607
Sequence CCTGGCCTCAAGCCATCCTCCTG TAGGCAGGAGCCGCCGCCCCTGG
Strand - +
Off-target summary {0: 181, 1: 3199, 2: 18042, 3: 57057, 4: 240650} {0: 1, 1: 1, 2: 56, 3: 1920, 4: 23007}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!