ID: 1160796847_1160796858

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1160796847 1160796858
Species Human (GRCh38) Human (GRCh38)
Location 19:949547-949569 19:949585-949607
Sequence CCATCCTCCTGCCTCGGCCTCCC TAGGCAGGAGCCGCCGCCCCTGG
Strand - +
Off-target summary {0: 73, 1: 1998, 2: 65493, 3: 51066, 4: 24748} {0: 1, 1: 1, 2: 56, 3: 1920, 4: 23007}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!