ID: 1160796853_1160796869

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1160796853 1160796869
Species Human (GRCh38) Human (GRCh38)
Location 19:949564-949586 19:949617-949639
Sequence CCTCCCAAAGTGCTGGGATTATA TCCCTCCAGTGGATGCCTGCTGG
Strand - +
Off-target summary {0: 26361, 1: 319744, 2: 258545, 3: 142388, 4: 133448} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!