ID: 1160908066_1160908079

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1160908066 1160908079
Species Human (GRCh38) Human (GRCh38)
Location 19:1461011-1461033 19:1461047-1461069
Sequence CCACACTTGCCCCTCACCCCACC GCATCCTTCGGAACTTGTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 145, 4: 1176} {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!