ID: 1160952032_1160952043

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1160952032 1160952043
Species Human (GRCh38) Human (GRCh38)
Location 19:1672245-1672267 19:1672284-1672306
Sequence CCCCCGCTCGGGACGCCAGGGGT CGCCAGACTCCCCCAAACTCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!