|
Left Crispr |
Right Crispr |
| Crispr ID |
1160995381 |
1160995388 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:1879863-1879885
|
19:1879887-1879909
|
| Sequence |
CCCGCCTGGTCCCCTCTTGGGTG |
GCCCAGGCTGAGCTGCCCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 6, 2: 2, 3: 16, 4: 254} |
{0: 7, 1: 5, 2: 11, 3: 70, 4: 491} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|