|
Left Crispr |
Right Crispr |
Crispr ID |
1160995386 |
1160995388 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
19:1879874-1879896
|
19:1879887-1879909
|
Sequence |
CCCTCTTGGGTGTGCCCAGGCTG |
GCCCAGGCTGAGCTGCCCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 6, 1: 4, 2: 3, 3: 31, 4: 279} |
{0: 7, 1: 5, 2: 11, 3: 70, 4: 491} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|