|
Left Crispr |
Right Crispr |
| Crispr ID |
1160995387 |
1160995397 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:1879875-1879897
|
19:1879910-1879932
|
| Sequence |
CCTCTTGGGTGTGCCCAGGCTGA |
GTCGCCCTCACCTGGTGCGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 4, 2: 2, 3: 10, 4: 198} |
{0: 10, 1: 1, 2: 0, 3: 5, 4: 62} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|