ID: 1160995391_1160995393

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1160995391 1160995393
Species Human (GRCh38) Human (GRCh38)
Location 19:1879889-1879911 19:1879902-1879924
Sequence CCAGGCTGAGCTGCCCCCAGGGT CCCCCAGGGTCGCCCTCACCTGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 6, 3: 37, 4: 367} {0: 5, 1: 3, 2: 6, 3: 24, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!