ID: 1160995391_1160995402

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1160995391 1160995402
Species Human (GRCh38) Human (GRCh38)
Location 19:1879889-1879911 19:1879920-1879942
Sequence CCAGGCTGAGCTGCCCCCAGGGT CCTGGTGCGCAGGGCCTGCCAGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 6, 3: 37, 4: 367} {0: 11, 1: 0, 2: 2, 3: 39, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!