ID: 1161014505_1161014510

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1161014505 1161014510
Species Human (GRCh38) Human (GRCh38)
Location 19:1977095-1977117 19:1977112-1977134
Sequence CCAACACGGTGACCCAGCTGGAT CTGGATGGTGCCTGAGAGACGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 19, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!