ID: 1161063541_1161063548

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1161063541 1161063548
Species Human (GRCh38) Human (GRCh38)
Location 19:2226913-2226935 19:2226929-2226951
Sequence CCTGGGCCCCTTCCCGCCGGGAC CCGGGACCGCAGTTCGCGCTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 272} {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!