ID: 1161063545_1161063557

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1161063545 1161063557
Species Human (GRCh38) Human (GRCh38)
Location 19:2226925-2226947 19:2226964-2226986
Sequence CCCGCCGGGACCGCAGTTCGCGC GCAGGCCAACCTCGGCTCCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52} {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!