ID: 1161105909_1161105923

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1161105909 1161105923
Species Human (GRCh38) Human (GRCh38)
Location 19:2443954-2443976 19:2444005-2444027
Sequence CCCGAGCGTCCCAACAGCTGGGA CACAGGGAAATGCCTACGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 208, 4: 1660} {0: 1, 1: 0, 2: 0, 3: 4, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!