ID: 1161373678_1161373687

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1161373678 1161373687
Species Human (GRCh38) Human (GRCh38)
Location 19:3927918-3927940 19:3927948-3927970
Sequence CCTCCCCCAAAGTCCTGGTCAGC CCTTCCAACGATGAGTTTTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 250} {0: 1, 1: 0, 2: 1, 3: 3, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!