ID: 1161517611_1161517613

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1161517611 1161517613
Species Human (GRCh38) Human (GRCh38)
Location 19:4705031-4705053 19:4705049-4705071
Sequence CCTACACTCTGTGGAAAGCAGTG CAGTGTAAACACAAGGACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 186} {0: 1, 1: 0, 2: 36, 3: 1357, 4: 17314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!