ID: 1161525123_1161525130

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1161525123 1161525130
Species Human (GRCh38) Human (GRCh38)
Location 19:4749701-4749723 19:4749752-4749774
Sequence CCAGACCCTGTCTCAAAAAACCC AAAAAAAAAGACTGTAGAAAAGG
Strand - +
Off-target summary {0: 2, 1: 15, 2: 146, 3: 1159, 4: 3592} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!