ID: 1161525124_1161525130

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1161525124 1161525130
Species Human (GRCh38) Human (GRCh38)
Location 19:4749706-4749728 19:4749752-4749774
Sequence CCCTGTCTCAAAAAACCCCACAA AAAAAAAAAGACTGTAGAAAAGG
Strand - +
Off-target summary {0: 5, 1: 13, 2: 89, 3: 902, 4: 3619} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!