ID: 1161687753_1161687761

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1161687753 1161687761
Species Human (GRCh38) Human (GRCh38)
Location 19:5711788-5711810 19:5711830-5711852
Sequence CCTGGAAGTCCTCGTGGACAACG GCACCTCAGCCGGGAGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75} {0: 1, 1: 0, 2: 3, 3: 17, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!