ID: 1161752835_1161752845

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1161752835 1161752845
Species Human (GRCh38) Human (GRCh38)
Location 19:6110259-6110281 19:6110277-6110299
Sequence CCCGCGGGCGCACCACCCGGACG GGACGTTTGGGGTGAGCGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43} {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!