ID: 1161762785_1161762788

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1161762785 1161762788
Species Human (GRCh38) Human (GRCh38)
Location 19:6186864-6186886 19:6186886-6186908
Sequence CCGGCTATTTTTTTGCAGAGACC CCAATTTCACTGTGTTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 230, 4: 789} {0: 1, 1: 2, 2: 43, 3: 959, 4: 10646}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!