ID: 1161846343_1161846360

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1161846343 1161846360
Species Human (GRCh38) Human (GRCh38)
Location 19:6713736-6713758 19:6713772-6713794
Sequence CCCCCCACCTTCCCCACTCCCAG CCACCCCCCAGCCCCCCACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 22, 3: 191, 4: 1390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!