ID: 1161925705_1161925711

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1161925705 1161925711
Species Human (GRCh38) Human (GRCh38)
Location 19:7297522-7297544 19:7297552-7297574
Sequence CCAATCATGGCTCACTGTAACCT CTGGGTTCAAGCGATCTTCCTGG
Strand - +
Off-target summary {0: 4, 1: 74, 2: 914, 3: 2229, 4: 3163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!