ID: 1162393953_1162393958

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1162393953 1162393958
Species Human (GRCh38) Human (GRCh38)
Location 19:10405288-10405310 19:10405314-10405336
Sequence CCAGCTTCAGCAAAACAGGGTTC GAGCCTCAGCTTCCAGAACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!