ID: 1162421329_1162421337

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1162421329 1162421337
Species Human (GRCh38) Human (GRCh38)
Location 19:10567662-10567684 19:10567703-10567725
Sequence CCATGGAAACTTTCAAGGAACCT ACCAAAGACGCCCCCAGATATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 173} {0: 1, 1: 0, 2: 1, 3: 1, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!