ID: 1162633383_1162633387

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1162633383 1162633387
Species Human (GRCh38) Human (GRCh38)
Location 19:11946206-11946228 19:11946219-11946241
Sequence CCAGTCTTAGATCGTAAATGAGC GTAAATGAGCTGCCAAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 61} {0: 3, 1: 4, 2: 32, 3: 48, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!