ID: 1162665728_1162665734

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1162665728 1162665734
Species Human (GRCh38) Human (GRCh38)
Location 19:12210208-12210230 19:12210238-12210260
Sequence CCTCCGCCTCCCAGGTTCAAGCG TTGCCTCAGCCTGAGATTACAGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 41, 3: 106, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!