ID: 1162665731_1162665734

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1162665731 1162665734
Species Human (GRCh38) Human (GRCh38)
Location 19:12210217-12210239 19:12210238-12210260
Sequence CCCAGGTTCAAGCGATTCTCCTT TTGCCTCAGCCTGAGATTACAGG
Strand - +
Off-target summary {0: 342, 1: 25313, 2: 113246, 3: 192084, 4: 202159} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!