ID: 1162718540_1162718549

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1162718540 1162718549
Species Human (GRCh38) Human (GRCh38)
Location 19:12648341-12648363 19:12648386-12648408
Sequence CCGTTCTCCATTAGTGGCTCCGA AGCAGCCTTCGGTGCACCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 63} {0: 1, 1: 0, 2: 2, 3: 9, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!