ID: 1162924465_1162924481

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1162924465 1162924481
Species Human (GRCh38) Human (GRCh38)
Location 19:13923318-13923340 19:13923368-13923390
Sequence CCTCGTCCTCCCCAGGTGCCGCC CCTGGTCCAGCGGCCTGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 1570} {0: 1, 1: 0, 2: 1, 3: 36, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!