ID: 1162962367_1162962371

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1162962367 1162962371
Species Human (GRCh38) Human (GRCh38)
Location 19:14135884-14135906 19:14135909-14135931
Sequence CCACAGGGAAACCACGGTGGCTG GATCTCCGTGGGTTAAGAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 202} {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!