ID: 1162962368_1162962374

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1162962368 1162962374
Species Human (GRCh38) Human (GRCh38)
Location 19:14135895-14135917 19:14135921-14135943
Sequence CCACGGTGGCTGAAGATCTCCGT TTAAGAAATGGAGGCCGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55} {0: 1, 1: 0, 2: 4, 3: 25, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!