|
Left Crispr |
Right Crispr |
Crispr ID |
1163168532 |
1163168540 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
19:15514554-15514576
|
19:15514593-15514615
|
Sequence |
CCCAGCTACTCGGGAGGCTGAGG |
CCTGGGAGGCAGAAGTTGCAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576} |
{0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|