ID: 1163168532_1163168540

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1163168532 1163168540
Species Human (GRCh38) Human (GRCh38)
Location 19:15514554-15514576 19:15514593-15514615
Sequence CCCAGCTACTCGGGAGGCTGAGG CCTGGGAGGCAGAAGTTGCAGGG
Strand - +
Off-target summary {0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576} {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!