ID: 1163413760_1163413767

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1163413760 1163413767
Species Human (GRCh38) Human (GRCh38)
Location 19:17172984-17173006 19:17173028-17173050
Sequence CCACAAAAGCGTCACTGTCGAGA TCTTAAAGTGAACACTTCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47} {0: 1, 1: 6, 2: 108, 3: 514, 4: 1887}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!