ID: 1163565544_1163565550

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1163565544 1163565550
Species Human (GRCh38) Human (GRCh38)
Location 19:18049034-18049056 19:18049058-18049080
Sequence CCAGCACACCGAGACCATTGGCC CCATGGCCGTACCTGTACCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 6, 4: 70} {0: 1, 1: 0, 2: 1, 3: 9, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!